View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18280_low_9 (Length: 270)
Name: NF18280_low_9
Description: NF18280
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18280_low_9 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 1 - 270
Target Start/End: Original strand, 47583439 - 47583711
Alignment:
| Q |
1 |
aagtgcctcagggtaacaactaattagaaccaattctattactttttgcgatatctt---cagatcatagttcaattgattaaatcatgatttttagttt |
97 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47583439 |
aagtgtctcagggtaacaactaattagaaccaattctattactttttgtgatatcttcttcagatcatagttcaattgattaaatcatgatttttagttt |
47583538 |
T |
|
| Q |
98 |
cttattcagatgaattgatatgtagttgaatgtaaatgtgatgatgcaggtgacaaattcagggacaggagcacaggaaacagtgagaattgtagatcaa |
197 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
47583539 |
cttattccgatgaattgatatgtagttgaatgtaaatgtgatgatgcaggtgacaaattcaggtacaggagcacaggaaacagtgagaattgtagatcaa |
47583638 |
T |
|
| Q |
198 |
tgcagcaatggagggttggatttggatgtgggagtgtttaacagaatcgacacagatggcagaggataccaac |
270 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47583639 |
tgcagcaatggagggttggatttggatgtgggagtgtttaacagaatcgacacagatggcagaggataccaac |
47583711 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University