View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18281_low_14 (Length: 283)
Name: NF18281_low_14
Description: NF18281
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18281_low_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 69; Significance: 5e-31; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 203 - 279
Target Start/End: Complemental strand, 20854940 - 20854864
Alignment:
| Q |
203 |
gacttactatttcattccctctttagtggtagttcatttatgcagaaccttttgttgtttttcatcaatcagttcat |
279 |
Q |
| |
|
|||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20854940 |
gacttactatttcattgcctctttagtggaagttcatttatgcagaaccttttgttgtttttcatcaatcagttcat |
20854864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University