View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18281_low_16 (Length: 238)
Name: NF18281_low_16
Description: NF18281
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18281_low_16 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 210; Significance: 1e-115; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 5146479 - 5146258
Alignment:
| Q |
1 |
gtgagaagtttggaacgacaacacaaatgaaagagacattatactttaacctaaaattttaaaattttaagtatatgagtcatcttctttataaagtatt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||| |
|
|
| T |
5146479 |
gtgagaagtttggaacgacaacacaaatgaaagagacattatactttaacctaaaattttaaaattttaggtgtatgagtcatcttctttataaagtatt |
5146380 |
T |
|
| Q |
101 |
caacgtccacatttttaaacattatgaaacttctaaatcatacttattatacacaacaaatgagagaagtctattgtagatgctcactagtaaattgatc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
5146379 |
caacgtccacatttttaaacattatgaaacttctaaatcatacttattatacacaacaaatgagagaagtctattgtagatgctcacaagtaaattgatc |
5146280 |
T |
|
| Q |
201 |
caattcaaaataattaaattaa |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
5146279 |
caattcaaaataattaaattaa |
5146258 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 172 - 218
Target Start/End: Complemental strand, 5146182 - 5146136
Alignment:
| Q |
172 |
tattgtagatgctcactagtaaattgatccaattcaaaataattaaa |
218 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
5146182 |
tattgtagatgctcacaagtaaattgatccaattcaaaataattaaa |
5146136 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University