View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18281_low_17 (Length: 225)

Name: NF18281_low_17
Description: NF18281
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18281_low_17
NF18281_low_17
[»] chr7 (1 HSPs)
chr7 (22-118)||(28094160-28094256)


Alignment Details
Target: chr7 (Bit Score: 93; Significance: 2e-45; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 22 - 118
Target Start/End: Original strand, 28094160 - 28094256
Alignment:
22 agacaacagagggagaacctgaagttctttaagcaacgattcacacattgtttcttgatgagaaaactgactgctgcgtttgccgaacatcgaaaaa 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||    
28094160 agacaacagagggagaacctgaagttctttaagcaacgattcacacattgtttcttgatgagataactgactgctgcgtttgccgaacatcgaaaaa 28094256  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University