View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18281_low_17 (Length: 225)
Name: NF18281_low_17
Description: NF18281
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18281_low_17 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 93; Significance: 2e-45; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 22 - 118
Target Start/End: Original strand, 28094160 - 28094256
Alignment:
| Q |
22 |
agacaacagagggagaacctgaagttctttaagcaacgattcacacattgtttcttgatgagaaaactgactgctgcgtttgccgaacatcgaaaaa |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
28094160 |
agacaacagagggagaacctgaagttctttaagcaacgattcacacattgtttcttgatgagataactgactgctgcgtttgccgaacatcgaaaaa |
28094256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University