View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18282_high_29 (Length: 210)
Name: NF18282_high_29
Description: NF18282
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18282_high_29 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 13 - 196
Target Start/End: Complemental strand, 6457822 - 6457639
Alignment:
| Q |
13 |
gtgagaagaattttaataatttatgccaacatcaatcttttattttttggtcgaagtgctaacctcaatctacaaacctcttggaacgtttcatatatga |
112 |
Q |
| |
|
|||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
6457822 |
gtgaaaagaatattaataatttatgccaacatcaatcttttattttttggtcgaagtgctaacctcaatctacaaacctcttggaacgttacatatatga |
6457723 |
T |
 |
| Q |
113 |
tgagaacgatgttatgatagctagtactgtggcatgaaacttgacccacatgtccaatttaaggtcccaaatggggtcctattt |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
6457722 |
tgagaacgatgttatgatagctagtactgtggcatgatacttgacccacctgtccaatttaaggtcccaaatggggtcctattt |
6457639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University