View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18282_low_22 (Length: 274)
Name: NF18282_low_22
Description: NF18282
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18282_low_22 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 38 - 265
Target Start/End: Original strand, 8457913 - 8458140
Alignment:
| Q |
38 |
acgcaagaattgaaatcaagaactttagtgtaatttattttcttactactttatccacactttcaaaacactttcggattctcttgtatcctcttttgat |
137 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
8457913 |
acgcaagaattgaaatcaagaactttagtgtaatttattttcttactactttatccacactttcaaaacacttttggattctcttgtatcctcttttgat |
8458012 |
T |
 |
| Q |
138 |
agctcaacttcaagacatgtctcacaagtccgcattgatctacgtgtagtttctttcaacaagtagggtccaaaagtgctaaacaatgtgtgctcaactt |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
8458013 |
agctcaacttcaagacatgtctcacaagtccgcattgatctacgtgtagtttctttcaacaagtagggtccaaaagtggtaaacaatgtgtgctcaactt |
8458112 |
T |
 |
| Q |
238 |
ttggcactaaaaggatcatatttcatct |
265 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
8458113 |
ttggcactaaaaggatcatatttcatct |
8458140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University