View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18282_low_26 (Length: 238)
Name: NF18282_low_26
Description: NF18282
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18282_low_26 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 50549445 - 50549225
Alignment:
| Q |
1 |
caggtttactgccctctaaatctaaatttgttttatgatgaatgccttcaatgatttaagtatccttagttggaatattagaggtgcagttagttctgaa |
100 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50549445 |
caggtttactgccctctaaatcttaatttgttttatgatgaatgctttcaatgatttaagtatccttagttggaatattagaggtgcagttagttctgaa |
50549346 |
T |
|
| Q |
101 |
gggaaacgacaagctcatgtccttattcgtcgttataacccgatgttaatagttcttatggaaacccactgccaatttgctagagttgctaatttatggc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
50549345 |
gggaaacgacaagctcatgtccttattcgtcgttataacccgatgttaatagttcttatggaaacccactgccaatttgctagagttgctaatttctggc |
50549246 |
T |
|
| Q |
201 |
aaggcttggggtatgtgaaat |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
50549245 |
aaggcttggggtatgtgaaat |
50549225 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 109; Significance: 6e-55; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 97 - 221
Target Start/End: Original strand, 19759385 - 19759509
Alignment:
| Q |
97 |
tgaagggaaacgacaagctcatgtccttattcgtcgttataacccgatgttaatagttcttatggaaacccactgccaatttgctagagttgctaattta |
196 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
19759385 |
tgaagggaaacgacaagctcgtgtccttattcgtcgttataacccgatgttgatagttcttatggaaacccattgccaatttgctagagttgctaatttc |
19759484 |
T |
|
| Q |
197 |
tggcaaggcttggggtatgtgaaat |
221 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
19759485 |
tggcaaggcttggggtatgtgaaat |
19759509 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University