View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18283_high_8 (Length: 348)
Name: NF18283_high_8
Description: NF18283
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18283_high_8 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 333; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 333; E-Value: 0
Query Start/End: Original strand, 1 - 348
Target Start/End: Original strand, 29662021 - 29662369
Alignment:
| Q |
1 |
tgcctctactattattcttctcttcaaccttcttgagaataggatcagtttcatagaactgatcttcttttgttaaaccaccaacaatccaatcccaaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29662021 |
tgcctctactattattcttctcttcaaccttcttgagaataggatcagtttcatagaactgatcttcttttgttaaaccaccaacaatccaatcccaaaa |
29662120 |
T |
 |
| Q |
101 |
acctttctcttgcttgctactgccaccacctgtagtaccctttgcacctgtagccgcaaagactcttcctgttgttggaaccattggcaacatggtgata |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
29662121 |
acctttctcttgcttgctactgccaccacctgtagtaccctttgcacctgtagctgcaaagactcttcccgttgttggaaccattggcaacatggtgata |
29662220 |
T |
 |
| Q |
201 |
gaagccattaattctcctagcttaatttgaaaaattatatcaactag-aaactaaaatataatataaattctctttgcctagtgttattgatgatatata |
299 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29662221 |
gaagccattaattctcctagcttaatttgaaaaattatatcaactagaaaactaaaatataatataaattctctttgcctagtgttattgatgatatata |
29662320 |
T |
 |
| Q |
300 |
tatttgttttgtggctatttttgtgtagtaaatgtgaggagttggattg |
348 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29662321 |
tatttgttttgtggctatttttgtgtagtaaatgtgaggagttggattg |
29662369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University