View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18283_low_15 (Length: 221)
Name: NF18283_low_15
Description: NF18283
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18283_low_15 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 1 - 209
Target Start/End: Original strand, 24881549 - 24881750
Alignment:
| Q |
1 |
gcgataaatttctcgtaagtttagtatccttaatctgaacgaaatgaattggatagcataaattccccgtttgggaccaattaaaaattaaaatgcaaaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
24881549 |
gcgataaatttctcgtaagtttagtatccttaatctgaacgaaatgaattggatagcataaattccctgtttgggaccaatt-------aaaatgcaaaa |
24881641 |
T |
 |
| Q |
101 |
aggataaactatatcatctccaattctgagtttgaggattttaaaataccccttaattagtgagaaattgagaattctccgttctctttgctcttttgtc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24881642 |
aggataaactatatcatctccaattctgagtttgaggattttaaaataccccttaattagtgagaaattgagaattctccgttctctttgctcttttgtc |
24881741 |
T |
 |
| Q |
201 |
cctttgctt |
209 |
Q |
| |
|
|||| |||| |
|
|
| T |
24881742 |
ccttcgctt |
24881750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University