View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18284_high_21 (Length: 211)

Name: NF18284_high_21
Description: NF18284
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18284_high_21
NF18284_high_21
[»] chr3 (3 HSPs)
chr3 (1-202)||(50307200-50307398)
chr3 (1-38)||(50307688-50307725)
chr3 (4-40)||(50307605-50307641)


Alignment Details
Target: chr3 (Bit Score: 188; Significance: 1e-102; HSPs: 3)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 202
Target Start/End: Complemental strand, 50307398 - 50307200
Alignment:
1 catgttcttgaatattctcaatttcttctacttccccagcattatcattgtttgtgatagcttctttaacttttggttctgtcttagtttcaacaacatt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
50307398 catgttcttgaatattctcaatttcttctacttccccagcattatcattgtttgtgatagcttctttaacttttggttctgtcttagtttcaacaacatt 50307299  T
101 gattgtttctgttgtttcttcattattagtactactttttgtagcaagattctttgaactactcttcttagtagtaccttgttttggagtctttgatgat 200  Q
    |||||||||||||||||||||   ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
50307298 gattgtttctgttgtttcttc---attagtactactttttgtagcaagattctttgaactactcttcttagtagtaccttgttttggagtctttgatgat 50307202  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 38
Target Start/End: Complemental strand, 50307725 - 50307688
Alignment:
1 catgttcttgaatattctcaatttcttctacttcccca 38  Q
    |||||||||||||||||||||||| |||||||||||||    
50307725 catgttcttgaatattctcaattttttctacttcccca 50307688  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 4 - 40
Target Start/End: Complemental strand, 50307641 - 50307605
Alignment:
4 gttcttgaatattctcaatttcttctacttccccagc 40  Q
    ||||| ||||||||||||||| |||||||||||||||    
50307641 gttctagaatattctcaattttttctacttccccagc 50307605  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University