View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18284_high_22 (Length: 205)
Name: NF18284_high_22
Description: NF18284
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18284_high_22 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 106; Significance: 3e-53; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 41 - 192
Target Start/End: Complemental strand, 44708308 - 44708157
Alignment:
| Q |
41 |
gttgaactattgatctttaagcacaatacatatttgtaggagtcaacaatannnnnnngnnnnnnntgaaatcacataacaaataaaatcaaatgattga |
140 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||| |
|
|
| T |
44708308 |
gttgaactattgatctttaagcacaatacatatttgtaggagtcaacaatatttttttgaaaaaaatgaaatcacataacaaataaaatcaaatgattga |
44708209 |
T |
 |
| Q |
141 |
aatgaatctggacaatatgtatctggaccgaaagcaagcaagtattcatctc |
192 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44708208 |
aatgattctggacaatatgtatctggaccgaaagcaagcaagtattcatctc |
44708157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University