View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18284_high_9 (Length: 276)

Name: NF18284_high_9
Description: NF18284
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18284_high_9
NF18284_high_9
[»] chr3 (1 HSPs)
chr3 (179-256)||(9452733-9452810)


Alignment Details
Target: chr3 (Bit Score: 54; Significance: 4e-22; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 179 - 256
Target Start/End: Original strand, 9452733 - 9452810
Alignment:
179 agataagttggcatggcgatgctctaagcaactcaattaacattatgagtagaagcagtgtgattattgattcaatat 256  Q
    ||||| ||| |||| ||||||||| |||||||||||| |||||||| |||||||||||||||||||||||||||||||    
9452733 agatacgtttgcattgcgatgctccaagcaactcaataaacattataagtagaagcagtgtgattattgattcaatat 9452810  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University