View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18284_low_10 (Length: 276)
Name: NF18284_low_10
Description: NF18284
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18284_low_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 54; Significance: 4e-22; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 179 - 256
Target Start/End: Original strand, 9452733 - 9452810
Alignment:
| Q |
179 |
agataagttggcatggcgatgctctaagcaactcaattaacattatgagtagaagcagtgtgattattgattcaatat |
256 |
Q |
| |
|
||||| ||| |||| ||||||||| |||||||||||| |||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
9452733 |
agatacgtttgcattgcgatgctccaagcaactcaataaacattataagtagaagcagtgtgattattgattcaatat |
9452810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University