View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18284_low_14 (Length: 256)
Name: NF18284_low_14
Description: NF18284
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18284_low_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 141; Significance: 5e-74; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 94 - 238
Target Start/End: Complemental strand, 45066715 - 45066571
Alignment:
| Q |
94 |
gcattgataatctacatattactagtgaatcaatctaacattttcaatcatccaattccttttctaatgcaagcaagagttattccaattatccaattcc |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45066715 |
gcattgataatctacatattactagtgaatcaatctaacattttcaatcatccaattccttttctaatgcaagcaagagttattccaattatccaattcc |
45066616 |
T |
 |
| Q |
194 |
ttttgtatatcaagaaagacttattttatgattttcaatgtttac |
238 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45066615 |
ttttgtacatcaagaaagacttattttatgattttcaatgtttac |
45066571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 42 - 96
Target Start/End: Complemental strand, 45066982 - 45066928
Alignment:
| Q |
42 |
cttaatgagataatatggataaatatgaactttaaattatattgatatgatagca |
96 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45066982 |
cttaatgagataatatggataaatatgaactttaaattatattgatatgatagca |
45066928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 113 - 219
Target Start/End: Complemental strand, 45546337 - 45546230
Alignment:
| Q |
113 |
tactagtgaatcaa-tctaacattttcaatcatccaattccttttctaatgcaagcaagagttattccaattatccaattccttttgtatatcaagaaag |
211 |
Q |
| |
|
|||| ||||||||| ||||| | ||||||| |||||||| |||| |||||||||||||| ||||| ||| |||| |||||| |||| |||||| || |
|
|
| T |
45546337 |
tactggtgaatcaaatctaaaaatttcaatgatccaattgtttttgtaatgcaagcaagaattatttgaatgatcctattcctaatgtaaatcaaggaaa |
45546238 |
T |
 |
| Q |
212 |
acttattt |
219 |
Q |
| |
|
|||||||| |
|
|
| T |
45546237 |
acttattt |
45546230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University