View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18284_low_18 (Length: 243)
Name: NF18284_low_18
Description: NF18284
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18284_low_18 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 25 - 227
Target Start/End: Complemental strand, 32801552 - 32801348
Alignment:
| Q |
25 |
gagctatctagctttaagctcagatttcatcctctaatctctgaatcttatctaaaacctttgcttgcaaaattgaaaaagtcatatatatctttcttga |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32801552 |
gagctatctagctttaagctcagatttcatcctctaatctctgaatcttatctaaaacctttgcttgcaaaattgaaaaagtcatatatatctttcttga |
32801453 |
T |
|
| Q |
125 |
tgggtttcttcatatagatattgtctagctttagtgaaaggtgaagtgtgataaatcaaccagatgtaaaatgcaaaatctaaatat--atatgtagtag |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||| |
|
|
| T |
32801452 |
tgggtttcttcatatagatattgtctagctttagtgaaaggtgaagtgtgataaatcaaccagctgtaaaatgcaaaatctaaatatatatatgtagtag |
32801353 |
T |
|
| Q |
223 |
gttat |
227 |
Q |
| |
|
||||| |
|
|
| T |
32801352 |
gttat |
32801348 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University