View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18284_low_22 (Length: 218)
Name: NF18284_low_22
Description: NF18284
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18284_low_22 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 108; Significance: 2e-54; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 68 - 207
Target Start/End: Complemental strand, 3002438 - 3002299
Alignment:
| Q |
68 |
ttggtactttcagtaggtctggttctgctctgcggagtattggttttatggttgtcgttggggcgtgctcagccttagtcagctgatgagaggtgttgtg |
167 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| ||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3002438 |
ttggtactttcagtaggtctggttctactctgcggggtattggttttctggttgtcgtcggggcgtgctcagccttagtcagctgatgagaggtgttgtg |
3002339 |
T |
 |
| Q |
168 |
ttgctgcaatttttatttggtcgcttttgcaaggtctgtg |
207 |
Q |
| |
|
||||||||||||||||||||| | |||| |||||| |||| |
|
|
| T |
3002338 |
ttgctgcaatttttatttggttgttttttcaaggtgtgtg |
3002299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 68 - 202
Target Start/End: Complemental strand, 3010824 - 3010690
Alignment:
| Q |
68 |
ttggtactttcagtaggtctggttctgctctgcggagtattggttttatggttgtcgttggggcgtgctcagccttagtcagctgatgagaggtgttgtg |
167 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||| | ||||| |||||||||||||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
3010824 |
ttggtactttcagtaggtctggttctgctctgcggggtattggttatctggttatcgttggggcgtgctcagtcttagtccgctgatgagaggtgttgtg |
3010725 |
T |
 |
| Q |
168 |
ttgctgcaatttttatttggtcgcttttgcaaggt |
202 |
Q |
| |
|
||||||||||||||||||||| | ||||||||||| |
|
|
| T |
3010724 |
ttgctgcaatttttatttggttgtttttgcaaggt |
3010690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University