View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18284_low_23 (Length: 211)
Name: NF18284_low_23
Description: NF18284
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18284_low_23 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 188; Significance: 1e-102; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 202
Target Start/End: Complemental strand, 50307398 - 50307200
Alignment:
| Q |
1 |
catgttcttgaatattctcaatttcttctacttccccagcattatcattgtttgtgatagcttctttaacttttggttctgtcttagtttcaacaacatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50307398 |
catgttcttgaatattctcaatttcttctacttccccagcattatcattgtttgtgatagcttctttaacttttggttctgtcttagtttcaacaacatt |
50307299 |
T |
 |
| Q |
101 |
gattgtttctgttgtttcttcattattagtactactttttgtagcaagattctttgaactactcttcttagtagtaccttgttttggagtctttgatgat |
200 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50307298 |
gattgtttctgttgtttcttc---attagtactactttttgtagcaagattctttgaactactcttcttagtagtaccttgttttggagtctttgatgat |
50307202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 38
Target Start/End: Complemental strand, 50307725 - 50307688
Alignment:
| Q |
1 |
catgttcttgaatattctcaatttcttctacttcccca |
38 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
50307725 |
catgttcttgaatattctcaattttttctacttcccca |
50307688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 4 - 40
Target Start/End: Complemental strand, 50307641 - 50307605
Alignment:
| Q |
4 |
gttcttgaatattctcaatttcttctacttccccagc |
40 |
Q |
| |
|
||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
50307641 |
gttctagaatattctcaattttttctacttccccagc |
50307605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University