View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18285_low_20 (Length: 262)
Name: NF18285_low_20
Description: NF18285
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18285_low_20 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 19 - 249
Target Start/End: Original strand, 41655202 - 41655436
Alignment:
| Q |
19 |
ggttaaactgtcaattttatgcatatcaaatagatgttttaaaaacaataaaaataatttgcttgctattttat----ggacctgttgatatgtgccttc |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
41655202 |
ggttaaactgtcaattttatgcatatcaaatagatgttttaaaaacaataaaaataatttgcttgctattttatatatggacctgttgatatgtgccttc |
41655301 |
T |
|
| Q |
115 |
aattaagttaccataatttgactctgaaacaacttttacacattgtctacaggtttgttatgattggagcaaaggtacagaaaatcacaatccaactact |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||| |
|
|
| T |
41655302 |
aattaagttaccataatttgactctgaaacaacttttacacattgtctacaggtttgttatgattggagcaaaggtgcagaaactcacaatccaactact |
41655401 |
T |
|
| Q |
215 |
gcaaagaactacatttatttgcacataccacaggt |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
41655402 |
gcaaagaactacatttatttgcacataccacaggt |
41655436 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 64; Significance: 5e-28; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 158 - 249
Target Start/End: Complemental strand, 28812862 - 28812771
Alignment:
| Q |
158 |
tgtctacaggtttgttatgattggagcaaaggtacagaaaatcacaatccaactactgcaaagaactacatttatttgcacataccacaggt |
249 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| | |||||||||||||||||||| |||||||||||||| ||| ||||| |||||||||| |
|
|
| T |
28812862 |
tgtctataggtttgttatgattggagcaaaggtgcggaaaatcacaatccaactacagcaaagaactacatatatatgcacttaccacaggt |
28812771 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University