View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18287_high_12 (Length: 250)
Name: NF18287_high_12
Description: NF18287
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18287_high_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 15 - 234
Target Start/End: Complemental strand, 26427470 - 26427251
Alignment:
| Q |
15 |
gagaagaaagttgctgaaaggactatctcgccgcaaagtatggcggcgagagaaaggagaaggaagataactgagaagacacaagagcttgggaagttgg |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26427470 |
gagaagaaagttgctgaaaggactatctcgccgcaaagtatggcggcgagagaaaggagaaggaagataactgagaagacacaagagcttgggaagttgg |
26427371 |
T |
 |
| Q |
115 |
ttcctggtggaccaaagatgaacacagcagagatgcttaatgctgctgctaattatgtcaagtttcttcaagctcaagttggaatgcttcaacttatgga |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26427370 |
ttcctggtggaccaaagatgaacacagcagagatgcttaatgctgctgctaattatgtcaagtttcttcaagctcaagttggaatgcttcaacttatgga |
26427271 |
T |
 |
| Q |
215 |
aacatttagcaaggtaattg |
234 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
26427270 |
aacatttagcaaggtaattg |
26427251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 15 - 234
Target Start/End: Original strand, 28009411 - 28009630
Alignment:
| Q |
15 |
gagaagaaagttgctgaaaggactatctcgccgcaaagtatggcggcgagagaaaggagaaggaagataactgagaagacacaagagcttgggaagttgg |
114 |
Q |
| |
|
|||||||| ||| | ||||||||||||||| |||| ||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28009411 |
gagaagaaggttaccgaaaggactatctcgtcgcagagtatcgcggctcgagaaaggagaaggaagataactgagaagacacaagagcttgggaagttgg |
28009510 |
T |
 |
| Q |
115 |
ttcctggtggaccaaagatgaacacagcagagatgcttaatgctgctgctaattatgtcaagtttcttcaagctcaagttggaatgcttcaacttatgga |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28009511 |
ttcctggtggaccaaagatgaacacagcagagatgcttaatgctgctgctaattatgtcaagtttcttcaagctcaagttggaatgcttcaacttatgga |
28009610 |
T |
 |
| Q |
215 |
aacatttagcaaggtaattg |
234 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
28009611 |
aacatttagcaaggtaattg |
28009630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University