View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18287_low_17 (Length: 213)
Name: NF18287_low_17
Description: NF18287
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18287_low_17 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 89; Significance: 4e-43; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 89; E-Value: 4e-43
Query Start/End: Original strand, 67 - 192
Target Start/End: Original strand, 22638154 - 22638289
Alignment:
| Q |
67 |
gtgacattggaacaaattagttaatgtaattattagtaatagataatgggtcaatttggtcaaatcatattaatattatccaa----------tatagtt |
156 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
22638154 |
gtgacattggaacaaattagttaatgttattattagtaatagatcatgggtcaatttggtcaaatcatattaatattatccaagaatactttgcatagtt |
22638253 |
T |
 |
| Q |
157 |
tgagtgagaaaatgaaaataaataaataaatgttga |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
22638254 |
tgagtgagaaaatgaaaataaataaataaatgttga |
22638289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 17 - 49
Target Start/End: Original strand, 22638118 - 22638150
Alignment:
| Q |
17 |
taggtaacttttgatatctaatgagataattat |
49 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
22638118 |
taggtaactttagatatctaatgagataattat |
22638150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University