View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18288_high_10 (Length: 250)
Name: NF18288_high_10
Description: NF18288
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18288_high_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 234
Target Start/End: Complemental strand, 24834298 - 24834065
Alignment:
| Q |
1 |
ttaaaagaggtcgatggtgagccatttctttaccacttttaaaagtattttggtactttgtagtttgtacataatcttatatctagttttagtaacatta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
24834298 |
ttaaaagaggtcgatggtgagccatttctttaccacttttaaaagtattttggtactttgtagtttgtacataatcttaaatctagttttagtaacatta |
24834199 |
T |
 |
| Q |
101 |
atttattctcnnnnnnncattgcagcacaacgtacatgcaaaacagatgctgattgtccaaaaattccaagattgtatccaacaatttataagtgccttg |
200 |
Q |
| |
|
||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
24834198 |
gtttattctctttttttcattgcagcacaacgtacatgtaaaacagatgctgattgtccaaaaattccaagcttgtatccaacaatttataagtgccttg |
24834099 |
T |
 |
| Q |
201 |
acggaatatgtagactttctgaagcgaagcttct |
234 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
24834098 |
acggaatatgtagattttctgaagcgaagcttct |
24834065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University