View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18288_high_2 (Length: 465)

Name: NF18288_high_2
Description: NF18288
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18288_high_2
NF18288_high_2
[»] chr4 (1 HSPs)
chr4 (1-150)||(26437816-26437965)


Alignment Details
Target: chr4 (Bit Score: 130; Significance: 3e-67; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 130; E-Value: 3e-67
Query Start/End: Original strand, 1 - 150
Target Start/End: Original strand, 26437816 - 26437965
Alignment:
1 aacgtttaaattacaacaactttctcatatctgatactgcttttgtgctcgttgcgatttttcttctaattatttgatgctgattgctaatccaacccct 100  Q
    ||||||||||||||||||||||||||| |||||||| |||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
26437816 aacgtttaaattacaacaactttctcacatctgatattgctgttgtgctcgttgcgatttttcttctaattatttgatggtgattgctaatccaacccct 26437915  T
101 tgaaaatgctggatttggctggaagctaacttttggcaatgtataatttt 150  Q
    |||||||||||||||| |||||||||||||||||||||||||||||||||    
26437916 tgaaaatgctggatttcgctggaagctaacttttggcaatgtataatttt 26437965  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University