View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18288_high_2 (Length: 465)
Name: NF18288_high_2
Description: NF18288
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18288_high_2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 130; Significance: 3e-67; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 130; E-Value: 3e-67
Query Start/End: Original strand, 1 - 150
Target Start/End: Original strand, 26437816 - 26437965
Alignment:
| Q |
1 |
aacgtttaaattacaacaactttctcatatctgatactgcttttgtgctcgttgcgatttttcttctaattatttgatgctgattgctaatccaacccct |
100 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| |||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
26437816 |
aacgtttaaattacaacaactttctcacatctgatattgctgttgtgctcgttgcgatttttcttctaattatttgatggtgattgctaatccaacccct |
26437915 |
T |
 |
| Q |
101 |
tgaaaatgctggatttggctggaagctaacttttggcaatgtataatttt |
150 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
26437916 |
tgaaaatgctggatttcgctggaagctaacttttggcaatgtataatttt |
26437965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University