View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18288_low_15 (Length: 235)
Name: NF18288_low_15
Description: NF18288
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18288_low_15 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 42149700 - 42149480
Alignment:
| Q |
1 |
caatgccactgcaacgaccagactttgctgtaaactcagcttttgatatgaatgagcagcagcagctgcaacaacaacacttgacaatgtctttacaaca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42149700 |
caatgccactgcaacgaccagactttgctgtaaactcagcttttgatatgaatgagcagcagcagctgcaacaacaacacttgacaatgtctttacaaca |
42149601 |
T |
|
| Q |
101 |
gcctgatctttccgcttcaaagtttgctttccagatgaatgagcagcagcacaataagcaaccaactttcttccaacatcaactttttcctgaaggcatg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42149600 |
gcctgatctttccgcttcaaagtttgctttccagatgaatgagcagcagcacaataagcaaccaactttcttccaacatcaactttttcctgaaggcatg |
42149501 |
T |
|
| Q |
201 |
aatagctttactggtaccaac |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
42149500 |
aatagctttactggtaccaac |
42149480 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 67; Significance: 7e-30; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 63 - 137
Target Start/End: Original strand, 30835663 - 30835737
Alignment:
| Q |
63 |
cagctgcaacaacaacacttgacaatgtctttacaacagcctgatctttccgcttcaaagtttgctttccagatg |
137 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
30835663 |
cagctgcaacaacaacacttggcaatgtctttacaacagcctgatctttccgcttcaaagtttgctttacagatg |
30835737 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University