View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18289_high_6 (Length: 312)
Name: NF18289_high_6
Description: NF18289
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18289_high_6 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 44 - 305
Target Start/End: Original strand, 47688826 - 47689087
Alignment:
| Q |
44 |
atccattgatctgttgtaatatgtggtgctcacatcttcagccgatgtagctgcaattgcgagtggtgggtggtccaaatgatcattgtgcatatgcaga |
143 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47688826 |
atccattgatctgttgtaatatgtggtgctcacatcttcagccgatgtagctgcaattgtgagtggtgggtggtccaaatgatcattgtgcatatgcaga |
47688925 |
T |
|
| Q |
144 |
ggaatgctttgatgagtgaaattgttggagtttttacctgtgaggtgttgaactaatgatctgaactcagaagcatggcaatcccttaacagtataggat |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47688926 |
ggaatgctttgatgagtgaaattgttggagtttttacctgtgaggtgttgaactaatgatctgaactcagaagcatggcaatcccttaacagtataggat |
47689025 |
T |
|
| Q |
244 |
tagatatataggttaccttaactgttttctttagtgttttatgtattgccttttgatgatgt |
305 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
47689026 |
tagatatataggttaccttaactgttttctttagtgttttatgtattgccttttggtgatgt |
47689087 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University