View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18290_high_11 (Length: 298)

Name: NF18290_high_11
Description: NF18290
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18290_high_11
NF18290_high_11
[»] chr1 (1 HSPs)
chr1 (15-122)||(32193326-32193433)


Alignment Details
Target: chr1 (Bit Score: 104; Significance: 7e-52; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 104; E-Value: 7e-52
Query Start/End: Original strand, 15 - 122
Target Start/End: Complemental strand, 32193433 - 32193326
Alignment:
15 cacagacacatgctgcatattgtacggaaaagagaggcatggaaattattgtgatttgatgggcatggtatgcagctgtacgaattccatatgattcttg 114  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32193433 cacacacacatgctgcatattgtacggaaaagagaggcatggaaattattgtgatttgatgggcatggtatgcagctgtacgaattccatatgattcttg 32193334  T
115 actgtaag 122  Q
    ||||||||    
32193333 actgtaag 32193326  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University