View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18290_high_11 (Length: 298)
Name: NF18290_high_11
Description: NF18290
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18290_high_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 104; Significance: 7e-52; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 104; E-Value: 7e-52
Query Start/End: Original strand, 15 - 122
Target Start/End: Complemental strand, 32193433 - 32193326
Alignment:
| Q |
15 |
cacagacacatgctgcatattgtacggaaaagagaggcatggaaattattgtgatttgatgggcatggtatgcagctgtacgaattccatatgattcttg |
114 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32193433 |
cacacacacatgctgcatattgtacggaaaagagaggcatggaaattattgtgatttgatgggcatggtatgcagctgtacgaattccatatgattcttg |
32193334 |
T |
 |
| Q |
115 |
actgtaag |
122 |
Q |
| |
|
|||||||| |
|
|
| T |
32193333 |
actgtaag |
32193326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University