View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18290_high_18 (Length: 237)
Name: NF18290_high_18
Description: NF18290
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18290_high_18 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 214
Target Start/End: Original strand, 36152199 - 36152412
Alignment:
| Q |
1 |
aagttatgctccatcaaaaaagttaaccttttcttagcaattggttatgcaccatcttcctacaagaaaaaatctcttccaagaggtgagtgttaggtga |
100 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36152199 |
aagttatgctccatcaaaaatgttaaccttttcttagcaattggttatgcaccatcttcctacaagaaaaaatctcttccaagaggtgagtgttaggtga |
36152298 |
T |
 |
| Q |
101 |
tgtaggggaggcgggttgccatagggtgatgaggacatggaaaccgtggatcgcttgtttaccacttgtgatttcgctagtaaaatttggcatgagaatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36152299 |
tgtaggggaggcgggttgccatagggtgatgaggacatggaaaccgaggatcgcttgtttaccacttgtgatttcgctagtaaaatttggcatgagaatt |
36152398 |
T |
 |
| Q |
201 |
tcaaatggcttggt |
214 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
36152399 |
tcaaatggcttggt |
36152412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University