View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18290_high_18 (Length: 237)

Name: NF18290_high_18
Description: NF18290
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18290_high_18
NF18290_high_18
[»] chr8 (1 HSPs)
chr8 (1-214)||(36152199-36152412)


Alignment Details
Target: chr8 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 214
Target Start/End: Original strand, 36152199 - 36152412
Alignment:
1 aagttatgctccatcaaaaaagttaaccttttcttagcaattggttatgcaccatcttcctacaagaaaaaatctcttccaagaggtgagtgttaggtga 100  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36152199 aagttatgctccatcaaaaatgttaaccttttcttagcaattggttatgcaccatcttcctacaagaaaaaatctcttccaagaggtgagtgttaggtga 36152298  T
101 tgtaggggaggcgggttgccatagggtgatgaggacatggaaaccgtggatcgcttgtttaccacttgtgatttcgctagtaaaatttggcatgagaatt 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    
36152299 tgtaggggaggcgggttgccatagggtgatgaggacatggaaaccgaggatcgcttgtttaccacttgtgatttcgctagtaaaatttggcatgagaatt 36152398  T
201 tcaaatggcttggt 214  Q
    ||||||||||||||    
36152399 tcaaatggcttggt 36152412  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University