View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18290_high_19 (Length: 228)
Name: NF18290_high_19
Description: NF18290
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18290_high_19 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 154; Significance: 8e-82; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 67 - 228
Target Start/End: Original strand, 8381988 - 8382149
Alignment:
| Q |
67 |
gtaagtgttgctcgaatgagtaaagaataacgtacgtaccgtaaatttgaacaagttgttgaatgtagggaatgacacgagggattatatcatccgacag |
166 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8381988 |
gtaagtgttgctcgattgagtaaagaataacgtacgtaccgtaaatttgaacaagttgttgaatgtagggaatgacacgagggattatatcatccgacag |
8382087 |
T |
 |
| Q |
167 |
ttccatgggtttggatttggcttgctttcccatcttatatgaatccttcaagtccccaagca |
228 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8382088 |
ttccatgggtttggatttggctttctttcccatcttatatgaatccttcaagtccccaagca |
8382149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University