View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18290_low_14 (Length: 285)
Name: NF18290_low_14
Description: NF18290
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18290_low_14 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 199; Significance: 1e-108; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 270
Target Start/End: Original strand, 6881272 - 6881542
Alignment:
| Q |
1 |
cctagttctcttaacgatggaggcacatttacaatttttgtgacctgtttgtatgcttagttagattttcggtttgttctcattgtcaattcagtcattg |
100 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6881272 |
cctagttctcttaatgatggaggcacatttacaatttttgtgaactgtttgtatgcttagttagattttcggtttgttctcattgtcaattcagtcattg |
6881371 |
T |
 |
| Q |
101 |
caattgtg-aaatgannnnnnnnnnnnnnnngctgccacagagaattctccatagtattcttgagtaaaagagattatgagcagagtagaataaagagag |
199 |
Q |
| |
|
|||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6881372 |
caattgtggaaatgatttttatttttattttgctgccacagagaattctccatagtattcttgagtaaaagagattatgagcagagtagaataaagagag |
6881471 |
T |
 |
| Q |
200 |
attgtttatatgtcagtttggtaaatacaggattcggttacagttgaacctgaattctcagtactgaattg |
270 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
6881472 |
attgtttatatgtcagtttggtaaatacagaattcggttacggttgaacctgaattctcagtactgaattg |
6881542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 28 - 78
Target Start/End: Original strand, 6845715 - 6845765
Alignment:
| Q |
28 |
tttacaatttttgtgacctgtttgtatgcttagttagattttcggtttgtt |
78 |
Q |
| |
|
|||||||| || |||| |||||||||||||||||||| ||||| ||||||| |
|
|
| T |
6845715 |
tttacaatcttcgtgaactgtttgtatgcttagttaggttttcagtttgtt |
6845765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University