View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18290_low_24 (Length: 206)

Name: NF18290_low_24
Description: NF18290
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18290_low_24
NF18290_low_24
[»] chr8 (1 HSPs)
chr8 (124-188)||(34408950-34409014)


Alignment Details
Target: chr8 (Bit Score: 65; Significance: 9e-29; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 65; E-Value: 9e-29
Query Start/End: Original strand, 124 - 188
Target Start/End: Complemental strand, 34409014 - 34408950
Alignment:
124 taccatcccatcttagacatggcgtaaggaagggtgagaacgccggcgccaaccatggccgtgat 188  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34409014 taccatcccatcttagacatggcgtaaggaagggtgagaacgccggcgccaaccatggccgtgat 34408950  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University