View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18291_high_17 (Length: 468)
Name: NF18291_high_17
Description: NF18291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18291_high_17 |
 | |
|
| [»] scaffold0122 (1 HSPs) |
| | |
|
Alignment Details
Target: chr8 (Bit Score: 77; Significance: 1e-35; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 381 - 457
Target Start/End: Original strand, 25639727 - 25639803
Alignment:
| Q |
381 |
tatgggaaatgctcaatcttgcgaaaattatatcaagggcgtatcataaagctatgtggcatcacaacttgcctatg |
457 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25639727 |
tatgggaaatgctcaatcttgcgaaaattatatcaagggcgtatcataaagctatgtggcatcacaacttgcctatg |
25639803 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 72; Significance: 1e-32; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 282 - 457
Target Start/End: Complemental strand, 24219518 - 24219343
Alignment:
| Q |
282 |
tgtaattagaaacataatgcaattatttacacctttcaaaattttatattacaacacaattgcaaattgtaatttagaatccggaattgattctaagatt |
381 |
Q |
| |
|
|||||| |||| ||||||||| ||||||||||| |||||| ||||| |||| | ||||||||||||||||||||||||| ||||||||||| ||| ||| |
|
|
| T |
24219518 |
tgtaatgagaaccataatgcagttatttacaccgttcaaatatttatgttacgatacaattgcaaattgtaatttagaattcggaattgattttaaaatt |
24219419 |
T |
|
| Q |
382 |
atgggaaatgctcaatcttgcgaaaattatatcaagggcgtatcataaagctatgtggcatcacaacttgcctatg |
457 |
Q |
| |
|
| |||||||||||| | || |||||||||||| | || ||||||| |||||||| ||| ||||||||||||| |
|
|
| T |
24219418 |
accagaaatgctcaatatagcaaaaattatatcacgcacgcatcataatactatgtggtatcgcaacttgcctatg |
24219343 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0122 (Bit Score: 34; Significance: 0.0000000007; HSPs: 1)
Name: scaffold0122
Description:
Target: scaffold0122; HSP #1
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 200 - 245
Target Start/End: Complemental strand, 18999 - 18954
Alignment:
| Q |
200 |
agttaaattgtgtgatcacacacaactttccaaataaattttacac |
245 |
Q |
| |
|
||||||||||||||||||||||||| ||| |||| ||||||||||| |
|
|
| T |
18999 |
agttaaattgtgtgatcacacacaagttttcaaacaaattttacac |
18954 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University