View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18291_high_42 (Length: 265)
Name: NF18291_high_42
Description: NF18291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18291_high_42 |
 | |
|
| [»] scaffold0010 (1 HSPs) |
| | |
|
Alignment Details
Target: chr4 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 21 - 247
Target Start/End: Complemental strand, 54424980 - 54424747
Alignment:
| Q |
21 |
tattattaatcgtagaggtggtccagaccgtccttcctgggtcattagagg-------gatgctgtaaaaaactgcaacttatttgatatgcctcttcat |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||| |||||||||| |||| ||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
54424980 |
tattattaatcgtagaggtggtccagaccgtccttcgtggctcattagaggattccaagatgttgtaaaagactgcaacttatttgatatgcctcttcat |
54424881 |
T |
|
| Q |
114 |
ggttaccaattcacatggttcaagagcatcggcacgccctcctccaaggaagctcgcattgaccgtgctctagtcacatcttcctggcaaacacttaatc |
213 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
54424880 |
ggttgccaattcacatggttcaagagcatcggcacgccctcctccaaggaaactcgcattgaccgtgctctagtcacatcttcctggcaaacactttatc |
54424781 |
T |
|
| Q |
214 |
caaacgctgccctccagactttggtggcctctat |
247 |
Q |
| |
|
||||| ||||||||||||| |||||||||||||| |
|
|
| T |
54424780 |
caaactctgccctccagaccttggtggcctctat |
54424747 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 108; Significance: 3e-54; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 37 - 247
Target Start/End: Original strand, 20119878 - 20120095
Alignment:
| Q |
37 |
ggtggtccagaccgtccttcctgggtcattagagg-------gatgctgtaaaaaactgcaacttatttgatatgcctcttcatggttaccaattcacat |
129 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||| |||||||| ||| ||||||||||||||||||||||||| || ||||||||||||||| |
|
|
| T |
20119878 |
ggtggtccagaccgtccttcttggctcattagaggcttccaagatgctgttaaagactgcaacttatttgatatgcctctccacagttaccaattcacat |
20119977 |
T |
|
| Q |
130 |
ggttcaagagcatcggcacgccctcctccaaggaagctcgcattgaccgtgctctagtcacatcttcctggcaaacacttaatccaaacgctgccctcca |
229 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||||||| || ||||| |||||| | ||||||||||| |||||| |||| | ||||||||| ||||||| |
|
|
| T |
20119978 |
ggttcaagagcatcggcacaccctcttccaaggaagcccgtattgatcgtgctttggtcacatcttcttggcaatcactatacccaaacgcttccctcca |
20120077 |
T |
|
| Q |
230 |
gactttggtggcctctat |
247 |
Q |
| |
|
||| |||||||||||||| |
|
|
| T |
20120078 |
gaccttggtggcctctat |
20120095 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0010 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: scaffold0010
Description:
Target: scaffold0010; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 113 - 184
Target Start/End: Complemental strand, 240176 - 240105
Alignment:
| Q |
113 |
tggttaccaattcacatggttcaagagcatcggcacgccctcctccaaggaagctcgcattgaccgtgctct |
184 |
Q |
| |
|
||||||||||| |||||||||||| || ||||| || | ||| || |||||||| ||||||||||||||||| |
|
|
| T |
240176 |
tggttaccaatacacatggttcaaaagtatcggaactcactcttcgaaggaagcccgcattgaccgtgctct |
240105 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 1 - 37
Target Start/End: Original strand, 15107429 - 15107465
Alignment:
| Q |
1 |
ataaaatatcaaattggtcatattattaatcgtagag |
37 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| |
|
|
| T |
15107429 |
ataaaatatcaaattggctatattattaatcgtagag |
15107465 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University