View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18291_high_45 (Length: 258)
Name: NF18291_high_45
Description: NF18291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18291_high_45 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 101; Significance: 4e-50; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 140 - 240
Target Start/End: Complemental strand, 41410405 - 41410305
Alignment:
| Q |
140 |
ccttgccagagccagccatggcgatgacggtgcgagagggtttgggggaggagatggataaacgaagattgggatgaatggcatcgaagaaggggttggt |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41410405 |
ccttgccagagccagccatggcgatgacggtgcgagagggtttgggggaggagatggataaacgaagattgggatgaatggcatcgaagaaggggttggt |
41410306 |
T |
 |
| Q |
240 |
g |
240 |
Q |
| |
|
| |
|
|
| T |
41410305 |
g |
41410305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University