View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18291_high_46 (Length: 237)
Name: NF18291_high_46
Description: NF18291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18291_high_46 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 121; Significance: 4e-62; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 17 - 141
Target Start/End: Complemental strand, 20054789 - 20054665
Alignment:
| Q |
17 |
atcatctgttccactgattccaaaattcaacttcaatatagaagaaaccatatattttgggcagtgtgtttggtttgccgttttgtgccatacatattga |
116 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20054789 |
atcatctgttccattgattccaaaattcaacttcaatatagaagaaaccatatattttgggcagtgtgtttggtttgccgttttgtgccatacatattga |
20054690 |
T |
|
| Q |
117 |
actcttttattacggagaaatgcaa |
141 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
20054689 |
actcttttattacggagaaatgcaa |
20054665 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 140 - 219
Target Start/End: Complemental strand, 20054625 - 20054546
Alignment:
| Q |
140 |
aactacgaactatagataatcactgttttgtgctagttatatatatcccaaagttgagattcaataactatagatattag |
219 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
20054625 |
aactacgaaatatagataatcactgttttgtgctagttatatatatcccaaaattgagattcaacaactatagatattag |
20054546 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 7 - 41
Target Start/End: Complemental strand, 15783027 - 15782993
Alignment:
| Q |
7 |
ttccaggagaatcatctgttccactgattccaaaa |
41 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| |
|
|
| T |
15783027 |
ttccaggaggatcatctgttccactgattccaaaa |
15782993 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University