View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18291_high_47 (Length: 229)
Name: NF18291_high_47
Description: NF18291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18291_high_47 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 95; Significance: 1e-46; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 8 - 126
Target Start/End: Complemental strand, 8259616 - 8259498
Alignment:
| Q |
8 |
gagtgagatgaaataagttaacattgttgttgtgaaaaattaattaaaatgtcatgtggtcaagtgatatccgcatgttcaattaagtacctttattttc |
107 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||| |
|
|
| T |
8259616 |
gagtgagatgaaataagttatctttgttgttgtgaaaaattaattaaaatgtcatgtggtcaagtgatatccgcaggttcaattaagtacctttaatttt |
8259517 |
T |
 |
| Q |
108 |
ataggcttgattccatttg |
126 |
Q |
| |
|
|||||||||||||| |||| |
|
|
| T |
8259516 |
ataggcttgattccgtttg |
8259498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 167 - 213
Target Start/End: Complemental strand, 8259457 - 8259411
Alignment:
| Q |
167 |
acttattgccctcatttatttttgctgtgtaaattttaattgaatat |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8259457 |
acttattgccctcatttatttttgctgtgtaaattttaattgaatat |
8259411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University