View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18291_low_14 (Length: 504)
Name: NF18291_low_14
Description: NF18291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18291_low_14 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 194; Significance: 1e-105; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 269
Target Start/End: Complemental strand, 30563824 - 30563547
Alignment:
| Q |
1 |
gagctgtaacagagagtttctcctcaatttcctttctcttcttactgtcatatactttcactttcattctctctataaatatatctcaacttgtt----- |
95 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30563824 |
gagctgtaacagagagtttctcctcaatttcccttctcttcttactgtcatgtactttcactttcattctctctataaatatatctcaacttgttcaact |
30563725 |
T |
|
| Q |
96 |
----ttttgtctcacacttcatcttctttcacatagttacctattacaagccactcactttatgtgtacatgaaattcaacaccttgttttgcatgtttg |
191 |
Q |
| |
|
||||||||||| | | ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
30563724 |
tgttttttgtctcactcataatcttctttcacatagttacctattacaagccattcactttatgtgtacatgaaatttaacaccttgttttgcatgtttg |
30563625 |
T |
|
| Q |
192 |
ctactctactcttcactgttctgttctagtcacacttcagaatcaaatccttcattttaaacattactatacttgaaa |
269 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||| |||| |||| |||| |
|
|
| T |
30563624 |
ctactctactcttcactgttctgttctagtcacaccgcaaaatcaaatccttcattttaaacactactgtactagaaa |
30563547 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 319 - 422
Target Start/End: Complemental strand, 30563343 - 30563239
Alignment:
| Q |
319 |
tgcactttcattgtttattctttt-caaaattgcaactagttcgtatgatggtctcttccattcttttcttgatcattcctttcaaaaggccatcatgtg |
417 |
Q |
| |
|
|||||||||| | | ||||||||| || | ||| ||||||||| ||||||||||| ||||||||||| |||||||||||||| ||| | ||| ||||| |
|
|
| T |
30563343 |
tgcactttcactctatattctttttcatacttgaaactagttcatatgatggtcttttccattctttgtttgatcattccttttaaatgatcattatgtg |
30563244 |
T |
|
| Q |
418 |
agtac |
422 |
Q |
| |
|
||||| |
|
|
| T |
30563243 |
agtac |
30563239 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University