View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18291_low_36 (Length: 295)

Name: NF18291_low_36
Description: NF18291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18291_low_36
NF18291_low_36
[»] chr1 (1 HSPs)
chr1 (14-276)||(51154597-51154859)


Alignment Details
Target: chr1 (Bit Score: 263; Significance: 1e-147; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 263; E-Value: 1e-147
Query Start/End: Original strand, 14 - 276
Target Start/End: Original strand, 51154597 - 51154859
Alignment:
14 agaggaaagtagataacttaacgaaagatttagatagaagatatgatggatcatataaactgaagacgaagatgcttgagttgcaagtaacagatcatag 113  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
51154597 agaggaaagtagataacttaacgaaagatttagatagaagatatgatggatcatataaactgaagacgaagatgcttgagttgcaagtaacagatcatag 51154696  T
114 atcagaagaagagtctgttcgtgaagaagaatgcttaatggataaaggtgattacttggagacactgaggagaaaacttgaggtagagaaggagaagcat 213  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
51154697 atcagaagaagagtctgttcgtgaagaagaatgcttaatggataaaggtgattacttggagacactgaggagaaaacttgaggtagagaaggagaagcat 51154796  T
214 tacagttgcatgcaagaaactcagaggatgacattgaatggattgcaatttgggttttctcaa 276  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
51154797 tacagttgcatgcaagaaactcagaggatgacattgaatggattgcaatttgggttttctcaa 51154859  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University