View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18291_low_40 (Length: 274)
Name: NF18291_low_40
Description: NF18291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18291_low_40 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 17 - 262
Target Start/End: Original strand, 38155930 - 38156174
Alignment:
| Q |
17 |
ataaatatcattcggtttcataacattaaacatcaagagattgcactcaactgtaacctactttgatcaaagtgttcatcatttcaatacctcttgcgaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38155930 |
ataaatatcattcggtttcataacattaaacatcaagagattgcactcaactgtaacctactttgatcaaagtgttcatcatttcaatacctcttgcgaa |
38156029 |
T |
|
| Q |
117 |
aaatatatagatatgagcatttatcctatgtatgtattcaaattaaccttacatctattgaatgatagcagatcccagccctaatcacactcttgtaaac |
216 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38156030 |
aaatatatagatatgaggatttatcctatgtatgtattcaaattaaccttacatctattgaatgatagcagatcccagccctaatcacactcttgtaaac |
38156129 |
T |
|
| Q |
217 |
acctttaatcttcttttaagtagtacagattaaatgagtgaatatt |
262 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
38156130 |
acctttaatcttc-tttaagtagtacagattaaatgagtgaatatt |
38156174 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University