View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18291_low_51 (Length: 225)
Name: NF18291_low_51
Description: NF18291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18291_low_51 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 13 - 203
Target Start/End: Complemental strand, 15570661 - 15570471
Alignment:
| Q |
13 |
caaaggaacaattacataaacataattaattatcaaataatctaaagacattagataactaatttttatccaaatggtgaacctctaccttgtgccatag |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15570661 |
caaaggaacaattacataaacataattaattatcaaataatctaaagacattagataactaatttttatccaaatggtgaacctctaccttgtgccatag |
15570562 |
T |
|
| Q |
113 |
taccagtactaatcataggactcattctttcagcatgatgagatggccctcttcttggtgaaggtctttcaagtttattcatagatgcatc |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15570561 |
taccagtactaatcataggactcattctttcagcatgaagagatggccctcttcttggtgaaggtctttcaagtttattcatagatgcatc |
15570471 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University