View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18291_low_52 (Length: 221)
Name: NF18291_low_52
Description: NF18291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18291_low_52 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 192; Significance: 1e-104; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 11 - 206
Target Start/End: Complemental strand, 47546194 - 47545999
Alignment:
| Q |
11 |
tgaagaagaaaaaattacataaggttcaaatgctaactagaatttccaccaactttatgtcagaatcagttaccatttctggagatacaagaggcaaata |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47546194 |
tgaagaagaaaaaattacataaggttcaaatgctaactagaatttccaccaactttatgtcagaatcagttaccatttctggagatacaagaggcaaata |
47546095 |
T |
 |
| Q |
111 |
cattggtgattttatgcaccgtgatagaggggaggggggagggaatatttctttggtgtgttatattaggacattgagttggaggatgagaatgtt |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
47546094 |
cattggtgattttatgcaccgtgatagaggggaggggggagggaatatttctttggtgtgttatattaggacatagagttggaggatgagaatgtt |
47545999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 25 - 99
Target Start/End: Complemental strand, 47538926 - 47538852
Alignment:
| Q |
25 |
ttacataaggttcaaatgctaactagaatttccaccaactttatgtcagaatcagttaccatttctggagataca |
99 |
Q |
| |
|
||||||||| | |||||| |||||||| ||||||| | |||||||||||||||||||||| || |||||||||| |
|
|
| T |
47538926 |
ttacataagttacaaatggtaactagagtttccactatctttatgtcagaatcagttacctcttttggagataca |
47538852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University