View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18293_low_7 (Length: 314)
Name: NF18293_low_7
Description: NF18293
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18293_low_7 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 1 - 301
Target Start/End: Complemental strand, 40455211 - 40454888
Alignment:
| Q |
1 |
caacttcttttgtgaatcactttgtcaagtgtcacgaactagcttgactttaaaacatcatcattcaagcattcacttatgttaattaactagctccttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40455211 |
caacttcttttgtgaatcactttgtcaagtgtcacgaactagcttgactttaaaacatcatcattcaagcattcacttatgttaattaactagctccttt |
40455112 |
T |
|
| Q |
101 |
aaacttattatatat---------------------gcactgctctatctttacaatgaagctctatgctacagcgagctaaacttttggtgaaaagaag |
179 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40455111 |
aaacttattatatattcttggcgaatatatatatatgcactgctctatctttacaatgaagctctatgctacagcgagctaaacttttggtgaaaagaag |
40455012 |
T |
|
| Q |
180 |
atggacggttataaagcaagcaccaaggcat--atatgcctccaaaaagttaaaccaataatcacttctgaacaaacgggtgatatttcatttgtatcat |
277 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
40455011 |
atggacggttataaagcaagcaccaaggcatatatatgcctccaaaaagttaaaccaataatcacttctgaacaaacgggtgatattttatttgtatcat |
40454912 |
T |
|
| Q |
278 |
attctatagttattttttatacta |
301 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
40454911 |
attctatagttattttttatacta |
40454888 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University