View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18294_high_7 (Length: 273)
Name: NF18294_high_7
Description: NF18294
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18294_high_7 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 25 - 265
Target Start/End: Complemental strand, 47053931 - 47053691
Alignment:
| Q |
25 |
cttttgtgagtcggtcattgcatgtcagctagcgctgccacaagcattttgtagactgatgaagctgccaatgtttggagaaagcttagtgattgtttct |
124 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47053931 |
cttttgtgagtcggtcattgcgtgtcagctagcgctgccacaagcattttgtagactgatgaagctgccaatgtttggagaaagcttagtgattgtttct |
47053832 |
T |
 |
| Q |
125 |
cagaagataacattggttagaaacttagaatttcataactcagcgtcgtctaagttccctaagctctattagggtttagtttcttcttagagaagagtgt |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
47053831 |
cagaagataacattggttagaaacttagaatttcataactcagcgtcgtctaagttccctaagctctgttagggtttagtttcttcttagagaagagtgt |
47053732 |
T |
 |
| Q |
225 |
gtgctcttccagcttggctcgtgtgtctctttgcctttgct |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47053731 |
gtgctcttccagcttggctcgtgtgtctctttgcctttgct |
47053691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University