View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18294_high_9 (Length: 257)
Name: NF18294_high_9
Description: NF18294
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18294_high_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 60; Significance: 1e-25; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 1 - 79
Target Start/End: Original strand, 32910894 - 32910970
Alignment:
| Q |
1 |
gacttggggtgggttttttctttgatttagtgcagtcacaaattcatagattcacgccgtaatcacattgatgatcgtt |
79 |
Q |
| |
|
|||||||||| ||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
32910894 |
gacttggggtaggttttttctttgatttggtgcagtcacaa--tcatagattcacgccgtaatcacattgatgatcgtt |
32910970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 153 - 202
Target Start/End: Original strand, 32911037 - 32911086
Alignment:
| Q |
153 |
tgtctgatcttgttccaacaatcattgatttgttgactatgcaaatgtgc |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
32911037 |
tgtctgatcttgttccaacaatcattgatttgttgactacgcaaatgtgc |
32911086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University