View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18294_low_11 (Length: 257)

Name: NF18294_low_11
Description: NF18294
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18294_low_11
NF18294_low_11
[»] chr7 (2 HSPs)
chr7 (1-79)||(32910894-32910970)
chr7 (153-202)||(32911037-32911086)


Alignment Details
Target: chr7 (Bit Score: 60; Significance: 1e-25; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 1 - 79
Target Start/End: Original strand, 32910894 - 32910970
Alignment:
1 gacttggggtgggttttttctttgatttagtgcagtcacaaattcatagattcacgccgtaatcacattgatgatcgtt 79  Q
    |||||||||| ||||||||||||||||| ||||||||||||  ||||||||||||||||||||||||||||||||||||    
32910894 gacttggggtaggttttttctttgatttggtgcagtcacaa--tcatagattcacgccgtaatcacattgatgatcgtt 32910970  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 153 - 202
Target Start/End: Original strand, 32911037 - 32911086
Alignment:
153 tgtctgatcttgttccaacaatcattgatttgttgactatgcaaatgtgc 202  Q
    ||||||||||||||||||||||||||||||||||||||| ||||||||||    
32911037 tgtctgatcttgttccaacaatcattgatttgttgactacgcaaatgtgc 32911086  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University