View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18295_high_6 (Length: 314)
Name: NF18295_high_6
Description: NF18295
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18295_high_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 147; Significance: 2e-77; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 147; E-Value: 2e-77
Query Start/End: Original strand, 16 - 166
Target Start/End: Complemental strand, 29135676 - 29135526
Alignment:
| Q |
16 |
agtttcaacctttatcactacttgtggaatcttaggtagcccttacgaaaaccctaacatcaacccgttgttcataggaattcccgattttcataaattg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29135676 |
agtttcaacctttatcactacttgtggaatcttaggtagcccttacgaaaaccctaacatcaacccgttgttcataggaattcccgattttcataaattg |
29135577 |
T |
 |
| Q |
116 |
ccaaaaatatcaaattgatgtgtcagttgatgatgagtgtgtttgttaccg |
166 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29135576 |
ccaaaaatatcaacttgatgtgtcagttgatgatgagtgtgtttgttaccg |
29135526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 224 - 310
Target Start/End: Complemental strand, 29135468 - 29135382
Alignment:
| Q |
224 |
acttgacatgaacacaattaactcatcaccattcataaaattggtctcaatacaagaaaaaatatgattataaatgtgagaataata |
310 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29135468 |
acttgacatgaacacaattaactcatcatcattcataaaattggtctcaatacaagaaaaaatatgattataaatgtgagaataata |
29135382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University