View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18295_low_8 (Length: 218)
Name: NF18295_low_8
Description: NF18295
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18295_low_8 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 126; Significance: 4e-65; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 70 - 203
Target Start/End: Original strand, 11493574 - 11493707
Alignment:
| Q |
70 |
cacacatctctttgcagaatttccaagtcatagacagatatgtcatagaaaaagaactgcactaattattttgcatgttgatcaatgttagctaagggac |
169 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11493574 |
cacacatctctttgcagaatttccaagtcatagacagatattacatagaaaaagaactgcactaattattttgcatgttgatcaatgttagctaagggac |
11493673 |
T |
|
| Q |
170 |
tgcaataatatttctaatatatggacgtgacgtg |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
11493674 |
tgcaataatatttctaatatatggacgtgacgtg |
11493707 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 1 - 75
Target Start/End: Original strand, 11493429 - 11493503
Alignment:
| Q |
1 |
aatgtccgtgtcggtgcttcacaggctactagtttatcaacaaattcaaaatatctgcatatcagttcacacaca |
75 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11493429 |
aatgtccgtgtcggtgcttcacaggctactagtttatcaacaaattcaaaatatctgcatatcagttcacacaca |
11493503 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University