View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18296_high_14 (Length: 292)
Name: NF18296_high_14
Description: NF18296
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18296_high_14 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 6 - 275
Target Start/End: Original strand, 38680986 - 38681255
Alignment:
| Q |
6 |
agcagcacagaatgaacttaatttaagtcagaagttcnnnnnnnttaatgtaaccattaatttacaaacttttgtctatatggaaaagatgattcaggga |
105 |
Q |
| |
|
|||| ||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
38680986 |
agcaacactgaatgaacttaatttaagtcagaagttcaaaaaaattaatgtaaccattaatttacaaacttttgtctatatggaaaaaatgattcaggga |
38681085 |
T |
|
| Q |
106 |
tgtgtgggttctcctccgccggacggtggcgcagggctgtttgcaagcaattgccaaacaagcccatattcactcgaccattgatcattatgtacaaaca |
205 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
38681086 |
tgagtgggttctcctccgccggacggtggcgcagggctgtttgcaagcaattgccaaacaagcccatattcactcgaccattgatcattatgtactaaca |
38681185 |
T |
|
| Q |
206 |
atggtctgcaagcaactccagattgaggagaagcaataaaaatggtaaacaagatcaacaaaatctgttg |
275 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38681186 |
atggtctgcaagcaactccagattgaggagaagcaataaaaatggtaaacaagatcaacaaaatctgttg |
38681255 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University