View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18296_high_15 (Length: 274)
Name: NF18296_high_15
Description: NF18296
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18296_high_15 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 19 - 271
Target Start/End: Original strand, 2617811 - 2618062
Alignment:
| Q |
19 |
gtttagtcattgggatcaatagaaaacacaagttaacctactcaaaatgtagaaatagatacccaatggttttattcatttgctatttatggttttaatg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
2617811 |
gtttagtcattgggatcaatagaaaacacaagttaacctactcaaaatgtagaaatagatacccaatggttt-attcatttgctatttatggttttaatg |
2617909 |
T |
|
| Q |
119 |
tagccccacgaaagcccgacattaaaatattagaaatttagactttttcatagattggaaatttagacgtttctttaacaaattgtgttgtacaagtact |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2617910 |
tagccccacgaaagcccgacattaaaatattagaaatttagactttttcatagattggaaatttagacgtttctttaacaaattgtgttgtacaagtact |
2618009 |
T |
|
| Q |
219 |
agtagattatctatcaaattcattcattaatttcattcaacctttgctactcc |
271 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||| |||||| |
|
|
| T |
2618010 |
agtagattatctatcaaattcattcattaatttcattcaaccattgatactcc |
2618062 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University