View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18296_high_18 (Length: 249)
Name: NF18296_high_18
Description: NF18296
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18296_high_18 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 23 - 242
Target Start/End: Original strand, 47160830 - 47161049
Alignment:
| Q |
23 |
atatccatgaaacttcaagcatttgtccttgatgtatccaaaaataccacattgagtgcaaagaggactatctttctttctagcttttggattggaacta |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47160830 |
atatccatgaaacttcaagcatttgtccttgatgtatccaaaaataccacattgagtgcaaagaggactatctttctttctagcttttggattggaacta |
47160929 |
T |
|
| Q |
123 |
gcaaattcttgacatgcaacagtaacaatatcgatttcgatggctcgttgtttttattcttggatcacaaaagaaaaatgtggctaatggaaggaaagta |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47160930 |
gcaaattcttgacatgcaacagtaacaatatcgatttcgatggctcgttgtttttattcttggatcacaaaagaaaaatgtggctaatggaaggaaagta |
47161029 |
T |
|
| Q |
223 |
atccataagtagtattatct |
242 |
Q |
| |
|
|||||||||||||| ||||| |
|
|
| T |
47161030 |
atccataagtagtagtatct |
47161049 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University