View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18296_low_13 (Length: 310)
Name: NF18296_low_13
Description: NF18296
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18296_low_13 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 101; Significance: 5e-50; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 101; E-Value: 5e-50
Query Start/End: Original strand, 49 - 157
Target Start/End: Complemental strand, 7593308 - 7593200
Alignment:
| Q |
49 |
cgaacaagtacaaaatcacatatacctcttcttcaagaactgaagttggtgattccgctggaggatcgtcgttcttcacattgttcttgggatccattat |
148 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
7593308 |
cgaacaagtacaaaatcacatatacctcttcttcaagaactgacgttggtgattccgctggaggatcgtcgttcttcacattgttcttgggatccatttt |
7593209 |
T |
 |
| Q |
149 |
tcaaaccct |
157 |
Q |
| |
|
||||||||| |
|
|
| T |
7593208 |
tcaaaccct |
7593200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 212 - 294
Target Start/End: Complemental strand, 7593137 - 7593055
Alignment:
| Q |
212 |
agagaacatttttagggttttgaagttgcaatgaaacttacgaagaagagaaaatgagattttggaagagaagatgaaaggag |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7593137 |
agagaacatttttagggttttgaagttgcaatgaaacttacgaagaagagaaaatgagattttggaagagaagatgaaaggag |
7593055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University