View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18296_low_25 (Length: 234)
Name: NF18296_low_25
Description: NF18296
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18296_low_25 |
 | |
|
| [»] scaffold0153 (1 HSPs) |
| | |
|
Alignment Details
Target: chr2 (Bit Score: 210; Significance: 1e-115; HSPs: 5)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 218
Target Start/End: Original strand, 11238304 - 11238521
Alignment:
| Q |
1 |
aaaatgtttgatgactgttacacaaattttatgatgtatgctgcaaaactgcttgttgctgggattgcttgaagcaatgtgaagtttctttatctacagt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11238304 |
aaaatgtttgatgactgttacacaaattttatgatgtatgctgcaaaaccgcttgttgctgggattgcttgaagcaatgtgaagtttctttatctacagt |
11238403 |
T |
|
| Q |
101 |
tggcatgacatatttctgccaaaaacaatgaactgtgatccaaaaacaatgaattgtgattctagattattcattattcctccaccattgcaatgataat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11238404 |
tggcatgacatatttctgccaaaaacaatgaactgtgatccaaaagcaatgaattgtgattctagattattcattattcctccaccattgcaatgataat |
11238503 |
T |
|
| Q |
201 |
atgtttcctgtctttctc |
218 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
11238504 |
atgtttcctgtctttctc |
11238521 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 65
Target Start/End: Complemental strand, 7168208 - 7168145
Alignment:
| Q |
1 |
aaaatgtttgatgactgttacacaaattttatgatgtatgctgcaaaactgcttgttgctgggat |
65 |
Q |
| |
|
||||||||||| ||||| ||||||| ||||||||||||||||||||||| || ||||| |||||| |
|
|
| T |
7168208 |
aaaatgtttgacgactgctacacaa-ttttatgatgtatgctgcaaaaccgcgtgttgttgggat |
7168145 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 7173783 - 7173735
Alignment:
| Q |
1 |
aaaatgtttgatgactgttacacaaattttatgatgtatgctgcaaaac |
49 |
Q |
| |
|
||||||||||||| ||| ||||||||||| ||||||||||||||||||| |
|
|
| T |
7173783 |
aaaatgtttgatggctgctacacaaatttgatgatgtatgctgcaaaac |
7173735 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 50
Target Start/End: Complemental strand, 7167078 - 7167029
Alignment:
| Q |
1 |
aaaatgtttgatgactgttacacaaattttatgatgtatgctgcaaaact |
50 |
Q |
| |
|
||||||||||||||||| |||| | |||||||||||||||||||||||| |
|
|
| T |
7167078 |
aaaatgtttgatgactgctacaaattttttatgatgtatgctgcaaaact |
7167029 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 172 - 218
Target Start/End: Complemental strand, 7160190 - 7160144
Alignment:
| Q |
172 |
cattattcctccaccattgcaatgataatatgtttcctgtctttctc |
218 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||||||| |||||||| |
|
|
| T |
7160190 |
cattattcctccaccatcccaatggtaatatgtttcctctctttctc |
7160144 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0153 (Bit Score: 44; Significance: 3e-16; HSPs: 1)
Name: scaffold0153
Description:
Target: scaffold0153; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 2 - 93
Target Start/End: Original strand, 29454 - 29544
Alignment:
| Q |
2 |
aaatgtttgatgactgttacacaaattttatgatgtatgctgcaaaactgcttgttgctgggattgcttgaagcaatgtgaagtttctttat |
93 |
Q |
| |
|
|||||||||| ||||| ||||||||||||||||||||||||||||||| || ||||| || || || |||||||| || | ||||||||||| |
|
|
| T |
29454 |
aaatgtttgacgactgctacacaaattttatgatgtatgctgcaaaaccgcctgttgttgaga-tgtttgaagcactgcggagtttctttat |
29544 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University